Detailed information of matrix profile CN0227.1

  1. Home
  2. Matrix > CN0227.1

Profile summary
Name: LM227
Matrix ID: CN0227.1
Class: Unknown
Family:
Collection: CNE
Taxon:
Species: Homo sapiens
Data Type:
Validation: 17442748
Uniprot ID:
Source:
Comment: -

Sequence logo

Frequency matrix

         
A [ 3 39 40 2 2 4 33 8 1 1 0 1 3 8 1 0 45 43 46 23 ]
C [ 0 6 1 0 0 2 1 1 0 3 44 4 6 1 0 2 0 0 1 1 ]
G [ 44 2 6 0 0 1 8 34 1 42 3 0 9 29 10 46 3 5 0 23 ]
T [ 1 1 1 46 46 41 6 5 46 2 1 43 30 10 37 0 0 0 1 1 ]

Binding sites information

No Binding sites available for this model.

External links

Matrix ID Base ID Version Name Species Family Class Sequence logo
CN0227.1 CN0227 1 LM227 Homo sapiens
Unknown
     
There is no centrality information of the model.
TFFM first order profile doesn't exist for this profile.
TFFM detailed profile doesn't exist for this profile.

Description:

Alias:

Symbol:

Consensus: GAATTTAGTGCTTGTGAAAA

Included Models:

GC Content: