Detailed information of matrix profile CN0220.1

  1. Home
  2. Matrix > CN0220.1

Profile summary
Name: LM220
Matrix ID: CN0220.1
Class: Unknown
Family:
Collection: CNE
Taxon:
Species: Homo sapiens
Data Type:
Validation: 17442748
Uniprot ID:
Source:
Comment: -

Sequence logo

Frequency matrix

         
A [ 6 8 0 45 2 0 2 4 1 0 42 43 47 18 0 0 3 1 39 3 ]
C [ 0 26 47 2 1 2 7 3 35 39 1 1 1 0 0 0 38 46 2 5 ]
G [ 8 4 0 1 0 0 0 10 1 0 1 4 0 26 0 44 0 0 0 11 ]
T [ 34 10 1 0 45 46 39 31 11 9 4 0 0 4 48 4 7 1 7 29 ]

Binding sites information

No Binding sites available for this model.

External links

Matrix ID Base ID Version Name Species Family Class Sequence logo
CN0220.1 CN0220 1 LM220 Homo sapiens
Unknown
     
There is no centrality information of the model.
TFFM first order profile doesn't exist for this profile.
TFFM detailed profile doesn't exist for this profile.

Description:

Alias:

Symbol:

Consensus: ATGGCACTTTGGAAAATGGA

Included Models:

GC Content: