Detailed information of matrix profile CN0213.1

  1. Home
  2. Matrix > CN0213.1

Profile summary
Name: LM213
Matrix ID: CN0213.1
Class: Unknown
Family:
Collection: CNE
Taxon:
Species: Homo sapiens
Data Type:
Validation: 17442748
Uniprot ID:
Source:
Comment: -

Sequence logo

Frequency matrix

         
A [ 0 1 6 25 1 1 1 80 94 10 11 93 43 4 6 8 96 99 95 8 ]
C [ 5 16 85 17 3 96 91 18 2 0 1 1 14 81 8 82 0 1 0 1 ]
G [ 0 2 1 1 2 0 0 5 7 91 88 8 28 3 1 4 6 3 6 89 ]
T [ 98 84 11 60 97 6 11 0 0 2 3 1 18 15 88 9 1 0 2 5 ]

Binding sites information

No Binding sites available for this model.

External links

Matrix ID Base ID Version Name Species Family Class Sequence logo
CN0213.1 CN0213 1 LM213 Homo sapiens
Unknown
     
There is no centrality information of the model.
TFFM first order profile doesn't exist for this profile.
TFFM detailed profile doesn't exist for this profile.

Description:

Alias:

Symbol:

Consensus: CTTTGAGTTCCTTGGAAGAA

Included Models:

GC Content: