Detailed information of matrix profile CN0209.1

  1. Home
  2. Matrix > CN0209.1

Profile summary
Name: LM209
Matrix ID: CN0209.1
Class: Unknown
Family:
Collection: CNE
Taxon:
Species: Homo sapiens
Data Type:
Validation: 17442748
Uniprot ID:
Source:
Comment: -

Sequence logo

Frequency matrix

         
A [ 3 7 2 38 2 3 1 1 29 0 44 43 45 4 7 44 39 37 10 6 ]
C [ 31 0 36 3 3 1 38 41 17 38 1 2 0 0 2 3 1 3 0 2 ]
G [ 5 1 8 3 0 4 7 0 0 7 0 0 0 42 38 0 0 3 2 36 ]
T [ 8 39 1 3 42 39 1 5 1 2 2 2 2 1 0 0 7 4 35 3 ]

Binding sites information

No Binding sites available for this model.

External links

Matrix ID Base ID Version Name Species Family Class Sequence logo
CN0209.1 CN0209 1 LM209 Homo sapiens
Unknown
     
There is no centrality information of the model.
TFFM first order profile doesn't exist for this profile.
TFFM detailed profile doesn't exist for this profile.

Description:

Alias:

Symbol:

Consensus: CATTTCCTTTGTGGAATGAG

Included Models:

GC Content: