Detailed information of matrix profile CN0196.1

  1. Home
  2. Matrix > CN0196.1

Profile summary
Name: LM196
Matrix ID: CN0196.1
Class: Unknown
Family:
Collection: CNE
Taxon:
Species: Homo sapiens
Data Type:
Validation: 17442748
Uniprot ID:
Source:
Comment: -

Sequence logo

Frequency matrix

         
A [ 10 0 2 1 0 46 42 46 7 6 5 42 40 45 39 3 1 42 31 14 ]
C [ 36 4 3 2 45 1 6 0 1 38 42 5 5 3 2 1 1 5 6 3 ]
G [ 4 0 0 0 5 0 2 3 42 3 0 1 3 0 7 3 44 0 1 0 ]
T [ 0 46 45 47 0 3 0 1 0 3 3 2 2 2 2 43 4 3 12 33 ]

Binding sites information

No Binding sites available for this model.

External links

Matrix ID Base ID Version Name Species Family Class Sequence logo
CN0196.1 CN0196 1 LM196 Homo sapiens
Unknown
     
There is no centrality information of the model.
TFFM first order profile doesn't exist for this profile.
TFFM detailed profile doesn't exist for this profile.

Description:

Alias:

Symbol:

Consensus: ATTCATTTTGGCTTTGAAAG

Included Models:

GC Content: