Detailed information of matrix profile CN0076.1

  1. Home
  2. Matrix > CN0076.1

Profile summary
Name: LM76
Matrix ID: CN0076.1
Class: Unknown
Family:
Collection: CNE
Taxon:
Species: Homo sapiens
Data Type:
Validation: 17442748
Uniprot ID:
Source:
Comment: -

Sequence logo

Frequency matrix

         
A [ 2 7 45 49 49 1 4 50 29 47 2 0 0 50 50 51 6 3 13 18 ]
C [ 3 33 0 0 1 0 3 1 10 1 1 0 44 0 1 0 1 1 2 1 ]
G [ 43 7 2 2 1 0 43 0 7 3 1 51 3 0 0 0 1 12 29 25 ]
T [ 3 4 4 0 0 50 1 0 5 0 47 0 4 1 0 0 43 35 7 7 ]

Binding sites information

No Binding sites available for this model.

External links

Matrix ID Base ID Version Name Species Family Class Sequence logo
CN0076.1 CN0076 1 LM76 Homo sapiens
Unknown
     
There is no centrality information of the model.
TFFM first order profile doesn't exist for this profile.
TFFM detailed profile doesn't exist for this profile.

Description:

Alias:

Symbol:

Consensus: CCAATTTGCATTTCATTTGC

Included Models:

GC Content: